Incyte GEM Materials and Methods

Microarray preparation

Sequences used for microarray fabrication are generated by PCR. PCR products are purified by gel filtration with Sephacryl-400 (Amersham Pharmacia Biotech, Inc., Piscataway, NJ) equilibrated in 0.2X SSC. The filtrate is dried down and rehydrated in one-tenth-volume dH2O for arraying. The DNA solutions are arrayed by robotics on modified glass surface and washed three times in dH2O at room temperature. Slides are then treated with 0.2% I-Block (Tropix, Bedford, MA) dissolved in 1X Dulbecco’s phosphate buffered saline (Life Technologies, Gaithersburg, MD) at 60°C for 30 minutes. GEM microarrays are then rinsed in 0.2% SDS for two minutes followed by three one minute washes in dH2O.

Fluorescent labeling of probe

Isolated mRNA is reverse transcribed with 5’ Cy3 or Cy5 labeled random 9-mers (Operone Technologies, Inc., Alameda, CA). Reactions are incubated for 2 hrs. at 37°C with 200 ng polyA RNA, 200 Units M-MLV reverse transcriptase (Life Technologies, Gaithersburg, MD), 4 mM DTT, 1 unit RNase Inhibitor (Ambion, Austin, TX), 0.5 mM dNTPs, and 2 μg labeled 9-mers in 25 μL volume with enzyme buffer supplied by the manufacturer. The reaction is terminated by incubation at 85°C for 5 min. The paired reactions are combined and purified with a TE-30 column (Clontech, Palo Alto, CA), brought to 90 μL with dH2O, and precipitated with 2 μL 1 mg/ml glycogen, 60 μL 5M NH4OAc, and 300 μL EtOH. After centrifugation the supernatant is decanted and the pellet is resuspended in 24 μL of hybridization buffer: 5X SSC, 0.2% SDS, 1 mM DTT.

Hybridization

Probe solutions are thoroughly resuspended by incubating at 65°C for 5 min. with mixing. The probe is applied to the array and covered with a 22mm2 glass cover-slip, and placed in a sealed chamber to prevent evaporation. After hybridization at 60°C for 6.5 hours slides are washed in three consecutive washes of decreasing ionic strength.

Scanning

Microarrays were scanned in both Cy3 and Cy5 channels with Axon GenePixTM scanners (Foster City, CA) with a 10 μm resolution. The signal is converted into 16-bits-per-pixel resolution, yielding a 65,536 count dynamic range.

Normalization and ratio determination

Incyte GEMtoolsTM software (Incyte Pharmaceuticals, Inc., Palo Alto, CA) was used for image analysis. The elements are determined by a gridding and region detection algorithm. The area surrounding each element image is used to calculate a local background and is subtracted from the total element signal. Background subtracted element signals are used to calculate Cy3:Cy5 ratios. The average of the resulting total Cy3 and Cy5 signal gives a ratio that is used to balance or normalize the signals.


Primers for cloning horse cDNAs

For androgen receptor (AR) cDNA:

The ligand-binding domain (in carboxy-terminus) of the androgen receptor was selected for cloning because it is specific for that receptor’s function. Sense and antisense primers were synthesized from flanking regions that were conserved between human and pig androgen receptor sequences (GenBank accession numbers XM_010429 and AF161717, respectively): (5’)GCGAGATGGGCCCCTGGATGG and (5’)GGAGTTGACATTGGTGAAGG for the initial PCR, and (5’)CTTATGGGGACATGCGTTTGG and (5’)ATTTAGGTGACATATAGAATACGCCAGCCCATGGCAAACACC, for nested PCR. The last included the SP6 RNA polymerase promoter sequence (underlined) so the PCR product could be used directly as a template for in vitro transcription of an antisense RNA probe.

For Golgi Apparatus protein 1 (GAP) cDNA cloning, primers were made from human cDNA sequence (GenBank accession number XM_049890) and were:

(5’)CAGGAGCTGGAGTGCCTTCA and (5’)GACACCCTGTGCTCCTTGG for the initial PCR, and (5’)CAGAGATGCATAATACGACTCACTATAGGGAGAGGACCATCTGGATGACTTGGT and (5’)CCAAGCCTTCATTAACCCTCACTAAAGGGAGATTCCTGCAGAGTGTCATTGC, for nested PCR. The last two included a 10 bp clamp (italicized) and either a T7 or T3 polymerase promoter sequence (underlined) so that antisense and sense cRNAs could be produced directly from the PCR product.

For cell division cycle 2 (CDC2) cDNA cloning, primers were made from human cDNA sequence (GenBank accession number BC014464) and were:

(5’)CAGCCCTTCCTGCCAGGGGA and (5’)TGAAGGTCATCTTTTTGAC for the initial PCR, and (5’)CAGAGATGCATAATACGACTCACTATAGGGAGAGGTGAAGACCCTGATGATCCA and (5’)CCAAGCCTTCATTAACCCTCACTAAAGGGAGAACTGGGAGCTCACTGTAGC, for nested PCR. The last two included a 10 bp clamp (italicized) and either a T7 or T3 polymerase promoter sequence (underlined) so that antisense and sense cRNAs could be produced directly from the PCR product.

For downregulated in ovarian cancer 1-myosin like (DOC1) cDNA cloning, primers were made from human cDNA sequence (GenBank accession number NM014890) and were: (5’)ACAAGAGCCTCATTCCTCT(3’) and (5’)AGAGGTTTTGGACTTTACTG(3’) for the initial PCR, and (5’)CAGAGATGCATAATACGACTCACTATAGGGAGAGAACGTGCAGTCATCAATGG(3’) and (5’)CCAAGCCTTCATTAACCCTCACTAAAGGGAGAGTGTTATGGAGGCGTTTTGGA(3’), for the nested PCR. The last two included a 10 bp clamp (italicized) and either a T7 or T3 polymerase promoter sequence (underlined) so that antisense and sense cRNAs could be produced directly from the PCR product.

Animals used in experiments

Horse ID
Microarray
Northern Blot
In situ hybridization
32
X
X
33
X
X
40
X
X
303
X
X
403
X
X
603
X
X
703
X
X